gRNA information of NbGR0001-1
gRNA
Name: NbGR0001-1
gRNA sequence: GCGCTGGCCAGTTGACAGTGG
Primer used to get the mutation
Organism: Nicotiana benthamiana (The reference genome is Niben101 which download from ftp://ftp.solgenomics.net/genomes/Nicotiana_benthamiana)
Position: Niben101Scf05245:0-0
Feature: Niben101Scf05245g01007 Forward primer: NA
Reverse primer: NA
Project & Transformation
Position: Niben101Scf05245:0-0
Feature: Niben101Scf05245g01007 Forward primer: NA
Reverse primer: NA
Project: Crispr/Cas9 Mediated Inactivation of Argonaute 2 Reveals its Differential Involvement in Antiviral Responses
RNA silencing constitutes an important antiviral mechanism in plants. Small RNA guided Argonaute proteins fulfill essential role in this process by acting as executors of viral restriction. Plants encode multiple Argonaute proteins of which several exhibit antiviral activities. A recent addition to ......
RNA silencing constitutes an important antiviral mechanism in plants. Small RNA guided Argonaute proteins fulfill essential role in this process by acting as executors of viral restriction. Plants encode multiple Argonaute proteins of which several exhibit antiviral activities. A recent addition to ......
Lab: Karoly Fatyol Lab, Agricultural Biotechnology Institute, National Agricultural Research and Innovation Centre, Szent-Gyorgyi Albert u. 4, Godollo, 2100, Hungary.
Contact: Karoly Fatyol; kfatyol@gmail.com
Transformation: NbRT0001 -- Construct: NbTG0001-1
This database is supported by NSF (IOS-1546625) and hosted by BTI.
