gRNA information of FxaGR0001-1
gRNA
Name: FxaGR0001-1
gRNA sequence: GACCTGATCGAGTAACTACTG
Primer used to get the mutation
Organism: Strawberry (using strawberry diploid reference v4.0.a1)
Position: Fvb4:0-0
Feature: FvH4_4g12690 Forward primer: NA
Reverse primer: NA
Project & Transformation
Position: Fvb4:0-0
Feature: FvH4_4g12690 Forward primer: NA
Reverse primer: NA
Project: CRISPR/Cas9?mediated mutagenesis of phytoene desaturase in diploid and octoploid strawberry
Background: Gene editing using CRISPR/Cas9 is a simple and powerful tool for elucidating genetic controls and for crop improvement and its use has been reported in a growing number of important food crops, including recently Fragaria. In order to inform application of the technology in Fragaria, we ......
Background: Gene editing using CRISPR/Cas9 is a simple and powerful tool for elucidating genetic controls and for crop improvement and its use has been reported in a growing number of important food crops, including recently Fragaria. In order to inform application of the technology in Fragaria, we ......
Lab: Wilson Lab; NIAB EMR, New Road, East Malling, Kent ME19 6BJ, UK
Contact: Fiona Wilson; fiona.wilson@emr.ac.uk
Transformation: FxaRT0001 -- Construct: FxaTG0001-1
This database is supported by NSF (IOS-1546625) and hosted by BTI.
