gRNA information of nCBP2-sgRNA


gRNA
Name: nCBP2-sgRNA
gRNA sequence: GCGAAAGAGAGAACCTTGAGAGG
Primer used to get the mutation
Organism: Cassava (the genome is download from phytozome v7.1)
Position: Chromosome08:0-0
Feature: Manes.08G145200
Forward primer: NA
Reverse primer: NA
Project & Transformation
Project: Simultaneous CRISPR/Cas9-mediated editing of cassava eIF4E isoforms nCBP-1 and nCBP-2 reduces cassava brown streak disease symptom severity and incidence
Cassava brown streak disease (CBSD) is a major constraint on cassava yields in East and Central Africa and threatens production in West Africa. CBSD is caused by two species of positive-sense RNA viruses belonging to the family Potyviridae, genus Ipomovirus: Cassava brown streak virus (CBSV) and Uga......
Lab: Rebecca Bart, Donald Danforth Plant Science Center
Contact: rbart@danforthcenter.org
Transformation: nCBP-1 -- Construct: nCBP-1



This database is supported by NSF (IOS-1546625) and hosted by BTI.